Supplementary Table 1. Genome-wide significant SNPs. P values are corrected using genomic controls.

Transcription

1 Supplementary Table 1. Genome-wide significant SNPs. P values are corrected using genomic controls. SNP Chr a position P value OR Test Build 35 rs C 12 87,830, x blond vs. brown hair rs A 14 91,834, x blond vs. brown hair 1.9x blue vs. green eyes rs T 14 91,850, x blond vs. brown hair 7.5x blue vs. green eyes rs G 14 91,870, x blond vs. brown hair rs A 15 25,830, x blue vs. brown eyes rs C 15 25,855, x blue vs. brown eyes rs G 15 25,873, x blue vs. brown eyes rs G 15 25,894, x blue vs. brown eyes rs G 15 26,009, x blue vs. brown eyes 5.3x blond vs. brown hair rs A 15 26,012, x blue vs. brown eyes 7.7x blond vs. brown hair 1.5x blue vs. green eyes rs G 15 26,017, x blue vs. brown eyes rs A 15 26,039, x blond vs. brown hair 8.0x blue vs. green eyes 2.2x blue vs. brown eyes rs C 15 26,162, x blue vs. brown eyes rs T 15 26,167, x blue vs. brown eyes rs C 15 26,189, x blond vs. brown hair 9.1x blue vs. green eyes 8.8x blue vs. brown eyes rs G 15 26,194, x blue vs. brown eyes rs A 15 26,199, x blue vs. brown eyes rs G 15 26,203, x blond vs. brown hair 5.1x blue vs. green eyes 1.4x blue vs. brown eyes rs T 15 26,208, x blue vs. brown eyes rs C 15 26,798, x blue vs. brown eyes rs G 16 87,584, x red vs. not red hair rs G 16 87,821, x red vs. not red hair rs C 16 87,871, x red vs. not red hair rs G 16 87,880, x red vs. not red hair rs A 16 87,882, x red vs. not red hair rs T 16 87,913, x red vs. not red hair 4.3x freckles present vs. absent rs C 16 87,914, x freckles present vs. absent rs C 16 88,098, x red vs. not red hair rs C 16 88,131, x freckles present vs. absent rs A 16 88,176, x freckles present vs. absent 6.3x red vs. not red hair rs T 16 88,183, x freckles present vs. absent rs C 16 88,219, x burns vs. tans 9.0x red vs. not red hair 1.4x freckles present vs. absent rs T 16 88,240, x freckles present vs. absent 2.0x red vs. not red hair rs G 16 88,253, x burns vs. tans 1.6x red vs. not red hair 4.7x freckles present vs. absent rs C 16 88,258, x red vs. not red hair 6.2x freckles present vs. absent

2 rs G 16 88,268, x red vs. not red hair rs A 16 88,281, x red vs. not red hair rs T 16 88,283, x burns vs. tans 5.6x red vs. not red hair 1.6x freckles present vs. absent rs C 16 88,292, x red vs. not red hair 1.1x burns vs. tans 4.9x freckles present vs. absent rs C 16 88,322, x burns vs. tans 1.1x freckles present vs. absent 1.4x red vs. not red hair rs T 16 88,332, x red vs. not red hair 1.6x freckles present vs. absent rs C 16 88,342, x freckles present vs. absent 1.5x red vs. not red hair rs C 16 88,363, x red vs. not red hair rs T 16 88,378, x red vs. not red hair rs A 16 88,397, x freckles present vs. absent 2.5x red vs. not red hair rs A 16 88,403, x red vs. not red hair 4.1x freckles present vs. absent rs C 16 88,447, x red vs. not red hair 5.2x freckles present vs. absent rs A 16 88,565, x red vs. not red hair rs T 16 88,571, x red vs. not red hair 2.8x burns vs. tans 2.0x freckles present vs. absent rs T 16 88,578, x red vs. not red hair 1.9x freckles present vs. absent 3.0x burns vs. tans rs G 16 88,586, x red vs. not red hair rs C 16 88,594, x freckles present vs. absent 1.1x burns vs. tans 3.2x red vs. not red hair rs T 16 88,596, x freckles present vs. absent 1.5x red vs. not red hair 3.4x burns vs. tans rs T 16 88,612, x red vs. not red hair 4.1x burns vs. tans 1.4x freckles present vs. absent rs T 16 88,615, x burns vs. tans 6.4x red vs. not red hair 7.0x freckles present vs. absent rs C 16 88,638, x red vs. not red hair rs C 16 88,657, x red vs. not red hair rs G 16 88,668, x red vs. not red hair 7.3x freckles present vs. absent 1.1x burns vs. tans rs C 6 402, x freckles present vs. absent rs G 6 411, x freckles present vs. absent

3 Supplementary Table 2. Frequencies in percentages of key SNPs in all phenotypes and all samples. The first line corresponds to the Icelandic Discovery sample, the second line the Icelandic replication sample, and the third the Dutch replication sample. Eye color Hair Color Skin sensitive Freckles Variant Locus All Blue Green Brown Dark Red Blond blond Brown Yes No Yes No rs T SLC24A rs C KITLG rs A P rs A TYR rs C TYR rs A OCA rs A OCA rs T MC1R rs T MC1R

4 Supplementary Table 3. Results from tests of positive selection based on population differentiation and extended haplotype homozygosity Allele frequency FST (perc. rank) a irehh value SNP Allele Gene/ Region (perc. rank) a Chrom. CEU YRI ASN CEU-YRI-ASN CEU-YRI CEU-ASN YRI-ASN CEU rs T SLC24A (9.1) (2.1) (45) (14) 1.02 (6.4) rs C KITLG (40) (40) (5.1) 0 (N/A) 6.96 (1.7) rs T 6p (14) (6.3) (30) (35) 1.29 (4.1) rs A TYR (0.81) (1.7) (0.37) 0 (N/A) 3.29 (0.55) rs A TYR (16) (12) (3.3) 0 (N/A) 0.94 (46) rs A OCA (2.7) (66) (0.79) (12) 0.5 (1.3) rs T OCA (0.54) (0.54) (0.66) (63) (0.32) rs T MC1R (41) (40) (5.1) 0 (N/A) 3.91 (6.6) rs T MC1R (50) (31) (16) 0 (N/A) 5.37 (6.2) a The percentile rank represents the percent of HapMap alleles of the same frequency in the groups examined that have a value of FST or irehh that is greater than or equal to that found for the specified allele.

5 Supplementary Table 4. Main association results, stratified by sex, for all samples. For each SNP, the first line contains the results for males, and the second for females. A P value testing for an overall difference of association between the sexes is given. OR (95% c.i.) Locus SNP Iceland Discovery Iceland replication Holland P Blue vs. brown eyes OCA2 rs (16.47,49.34) (9.63,28.18) (7.92,20.03) 0.12 OCA2 rs (20.97,45.59) 4.57 (1.34,15.61) (13.37,35.10) 3.65 (1.44,9.27) (13.84,45.04) 6.82 (2.87,16.22) (3.86,14.50) 7.15 (3.21,15.91) 2.71 (0.81,9.05) Blue vs green eyes SLC24A4 rs (1.55,3.35) 1.63 (1.21,2.19) 2.17 (1.35,3.50) (1.72,2.47) TYR rs (1.38,3.32) 1.45 (1.20,1.74) 1.23 (0.89,1.70) 2.05 (1.45,2.92) 1.25 (0.73,2.16) (1.19,1.75) OCA2 rs (2.71,14.08) 1.53 (1.24,1.89) 3.59 (1.80,7.20) 1.60 (1.08,2.37) 7.32 (3.28,16.37) (4.68,11.20) 7.64 (4.90,11.93) 7.75 (3.43,17.51) Red vs. not red hair MC1R rs (5.06,15.97) 4.54 (3.05,6.77) 2.80 (0.93,8.45) (5.54,10.42) MC1R rs (7.94,24.04) 4.51 (3.32,6.12) 5.32 (3.55,7.97) 4.51 (1.83,11.09) (4.63,29.06) (8.68,16.90) 6.72 (4.92,9.17) (6.83,37.32) Blond vs. brown hair SLC24A4 rs (1.77,3.47) 2.02 (1.50,2.74) 2.11 (1.54,2.87) 0.78 KITLG rs (2.07,3.26) 1.95 (1.30,2.93) 2.56 (2.01,3.25) 1.52 (1.06,2.17) 1.58 (1.10,2.27) 2.01 (1.25,3.23) OCA2 rs (1.92,3.24) 6.02 (2.47,14.64) 2.20 (1.65,2.94) 6.29 (2.81,14.09) 3.26 (1.76,6.05) 6.20 (3.35,11.45) 0.51 MC1R rs (2.79,7.83) 1.51 (0.84,2.72) 6.07 (3.39,10.86) 2.56 (1.67,3.93) 4.73 (2.40,9.34) 2.26 (1.22,4.16) 0.15 MC1R rs (1.37,2.66) 2.39 (1.37,4.14) 1.36 (0.96,1.93) 2.17 (1.43,3.31) 1.71 (0.93,3.14) 2.05 (1.08,3.89) (1.49,3.30) 1.88 (1.30,2.71) 0.91 (0.37,2.27) Skin sensitivity to sun TYR rs (1.00,1.59) 1.61 (1.31,1.98) 1.08 (0.84,1.38) 0.66 MC1R rs (1.08,1.46) 2.05 (1.46,2.86) 1.42 (1.19,1.69) 2.42 (1.89,3.09) 1.15 (0.87,1.52) 2.03 (1.38,3.01) 0.18 MC1R rs (1.95,2.90) 2.40 (1.69,3.41) 1.85 (1.50,2.28) 2.30 (1.77,3.00) 1.26 (0.82,1.95) 1.84 (1.20,2.82) (2.63,4.23) 2.70 (2.15,3.40) 2.56 (1.47,4.46) Freckles 6P25.3 rs (1.18,1.79) 1.18 (0.99,1.41) 1.22 (0.97,1.54) (1.23,1.61) TYR rs (0.93,1.46) 1.30 (1.11,1.52) 1.16 (0.95,1.42) 1.36 (1.06,1.74) 1.44 (1.13,1.84) 0.15 MC1R rs (1.22,1.63) 2.81 (2.02,3.92) 1.61 (1.35,1.91) 2.66 (2.08,3.40) 1.01 (0.78,1.30) 2.04 (1.36,3.04) 0.50 MC1R rs (2.07,3.09) 5.18 (3.63,7.41) 2.41 (1.92,3.01) 2.62 (2.02,3.40) 2.14 (1.37,3.33) 4.18 (2.71,6.46) (3.31,5.49) 2.64 (2.05,3.40) 4.64 (2.57,8.37)

6 Supplementary Table 5. The fraction of the variance of various phenotypes explained by the previously reported variants, by the new variants (after accounting for the previously reported ones), and by all the variants combined. All traits were treated as two class categorical variables, except hair shade which was treated as a quantitative variable (scoring blond hair as 1, dark blond or light brown hair as 2, and brown or black hair as 3). MC1R and OCA2 SLC24A4, TYR, KITLG and 6p25.3 All loci Phenotypes Iceland Holland Iceland Holland Iceland Holland Blue vs. brown eyes Blue vs. green eyes Brown vs. green eyes Red hair Hair shade (minus red) Skin sensitivity to sun Freckles

7 Supplementary Table 6. Inflation factors on χ 2 scale for each genome-wide association scan performed. The mean genomic inflation factor was used to correct P values. Test Mean genomic χ 2 Median genomic χ 2 Genealogy simulated χ 2 Blue vs. brown eyes Blue vs. green eyes Red hair Blond vs. brown hair Skin sensitivity to sun Freckles

8 Supplementary table 7. - Primers sequences for SNPs in Tables 2, 3 and 4. SNP Forward_primer Reverse_primer VIC-Probe FAM-Probe Enhancer rs AGCCCTGGGTCTTGATGTTGTA ATCTGGCGA*TCCA*ATTCTTTGT GACAAAGAGAAC GACAAAGAGACC CAAAATATACTGACCTAAA rs CAGGTGTGAAGTTGTGTGGCAGAA GTCATAAAGTTCCCTGGAGCCAAG TTTCCT*T*TAGTG TTTCCT*TTAGCG GCCGTAGTAACATG rs ACA*CACGTGA*TAGACTG ACA*GTA*ACCTGTGGAC AGCT*CAGCC AGCT*CA*ACC ACTCGTGCAGTTC rs GGTGAATGATA*ACA*CGAACAGATT GA*TGCGTGCATATCCACCAACT ACACAGATTTCG CACACAGATTTTG TGCAGAGAAGG*GA rs GCATTATTATGTGTCAATGGATGCACTGCT CGCAACAAGAAGAGTCTATGCCAAG GG*GGATCTGA TGG*GG*GATATGA ATCTGGAGAGACATT rs TCCACCATTAAGACGCAGCAATTCAA GAGACTTTGAGGTCTCCAAC GCA*TA*CAC A*CGTGCATATAC AAACAAACAAAGAAACAA rs GGCTTAGGAAGCAAGGCAAGTT TGGGTCGCCTGGCAGAGAG CCTAAA*GGTCA CCCTA*AAGGTTA TGTGCACAGACG

9 Supplementary Table 8. Correction factors for on χ 2 scale based on the first 10 principal components calculated using the EIGENSTRAT software package. Test 0.05 P > P > > P Blue vs. brown eyes Blue vs. green eyes Red hair Blond vs. brown hair Skin sensitivity to sun Freckles

10 Supplementary Table 9. Allele frequency of variants among different populations. Locus SLC24A4 KITLG SEC5L1 TYR TYR OCA2 MC1R MC1R SNP rs rs rs rs rs rs rs rs Allele T C A A C A T T Population N Iceland ,264 Holland ,214 US a ,276 CEU b CHB b JPT b YRI b Pigment effect Blond Blue vs. green eye Blond Freckle Blue vs. green eye a Cancer Genetic Markers of Susceptibility (CGEMS) b Hapmap populations Freckle Blond Blue eye Red hair Fair skin Freckles Red hair Fair skin Freckles

11 Supplementary Figure 1-6. Allelic association of Illumina SNP's with main skin and eye pigmentation characteristics. The small horizontal dots show all the genotyped SNP's indicating the coverage of each genomic region. The large dots correspond to the SNP's tested for association. The recombination hot spots are shown by the red strips. Genes are represented by the blue lines, with the exons as thin vertical bars and with an arrow in the direction of transcription. The graphical description of the genes was simplified in Figure 5.

12 Supplementary Figure 1. Supplementary Figure 2. Supplementary Figure 3.

13 Supplementary Figure 4.

14 Supplementary Figure 5. Supplementary Figure 6.