Mupirocin Resistance Related to Increasing Mupirocin Use in. Clinical Isolates of Methicillin-Resistant Staphylococcus

Transcription

1 JCM Accepts, published online ahead of print on 26 April 2010 J. Clin. Microbiol. doi: /jcm Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. Hogue Mupirocin Resistance Related to Increasing Mupirocin Use in Clinical Isolates of Methicillin-Resistant Staphylococcus aureus in a Pediatric Population Jacob S Hogue, MD, 1* Patricia Buttke, MD, 2 LoRanee E Braun, MD, 1 Mary P Fairchok, MD 1 1 Dept. of Pediatrics, Madigan Army Medical Center, 2 Penn State University College of Medicine Corresponding Author: Jacob Hogue; 433 Parnassus Ave, U100A, San Francisco, California, ; Phone: ; Fax: ; hoguej@peds.ucsf.edu Funding support: None Keywords: mupirocin, methicillin-resistant Staphylococcus aureus, antibiotic resistance Running title: Mupirocin resistance pediatrics Abbreviated Title: Mupirocin Resistance in Pediatric MRSA No reprints available. The opinions or assertions contained herein are the private views of the author(s) and are not to be construed as official or as reflecting the views of the Department of Defense. The investigators have adhered to the policies for protection of human subjects as prescribed in 45 CFR 46. Mupirocin resistance pediatrics 1

2 Abstract We investigated the proportion of methicillin resistant Staphylococcus aureus (MRSA) isolates from pediatric patients demonstrating mupirocin resistance related to mupirocin use at our institution. No mupirocin resistance was found in 98% of isolates, whereas mupirocin prescriptions increased by 110%. Resistance rates remained low despite increasing use of mupirocin. Downloaded from on December 12, 2018 by guest Mupirocin resistance pediatrics 2

3 25 Note Mupirocin is a topical antibiotic used to treat superficial skin infections and to control spread of methicillin resistant Staphylococcus aureus (MRSA). Mupirocin resistance was described shortly after it became available.(1-2) Prevalence of mupirocin resistance rates among MRSA isolates have been described in mostly hospitalized adult and elderly patients with wide variability ranging from 0-65% of isolates.(3-16) Rates of resistance have been shown to correlate with increased use in closed inpatient settings.(9,15) Rates of resistance among pediatric patients have not been as well studied, nor has there been a study evaluating the impact of increasing mupirocin use in a predominantly outpatient setting with resistance. In this study, we investigated the proportion of MRSA demonstrating mupirocin resistance among pediatric isolates in the face of increasing rates of mupirocin use at our institution. From November 2005 to October 2007, first-time MRSA isolates obtained from pediatric patients (0-18 years) at a military medical center in the northwest United States were screened for mupirocin resistance. Our institution includes a large primary care pediatric clinic in addition to an inpatient pediatric ward. Most of our isolates were obtained in the outpatient setting. To evaluate mupirocin prescription trends, mupirocin prescription data was extracted from the medical center s pharmacy database from January 2002 through December Our pharmacy database includes all prescriptions provided in both the outpatient and inpatient settings to patients served by our institution. Our institution does not have any formal guidelines limiting the prescription of mupirocin. All isolates were categorized as MRSA using routine antibiotic susceptibility testing per the established laboratory protocol. The MRSA phenotype identified using disk diffusion on Mueller-Hinton agar was confirmed with Vitek 2 (Biomerieux) identification and susceptibility Mupirocin resistance pediatrics 3

4 testing cards for gram positive bacteria. Isolates were stored at -70ºC awaiting further testing. Sub-cultures plated on blood agar (BBL TSA) were incubated for 24 hours prior to E-test and polymerase chain reaction (PCR). Mupirocin E-test (AB Biodisk; Minimum Inhibitory Concentration (MIC) range: µg/ml) was used according to the manufacturer s instructions on Mueller-Hinton agar. The MIC breakpoints were chosen to correlate with previous studies on mupirocin resistance.(8,12-13,16-17) Mupirocin susceptibility was defined as MIC <8 µg/ml, intermediate resistance as MIC µg/ml, and high level resistance as MIC 512 µg/ml. DNA was extracted using Roche MagNA Pure LC System. Real-time PCR assay was performed on the LightCycler PCR platform (Roche) using custom designed primers ordered from Sigma Genosys (The Woodlands, TX): Mup-F (5 TAATGGGAAATGTCTCGAGTAGA 3 ) and Mup-R (5 AATAAAATCAGCTGGAAAGTGTTG 3 ) primers and Mup-P probe (5 CTCTATGCCGTTTGCTCAGCATCAT). IDI-MRSA TM assay was performed according to manufacturer s instructions (GenOhm, San Diego, CA) using a SmartCycler II device (Cepheid, Sunnyvale, CA). Primers designed to detect mupirocin resistance were included with a SmartMix TM HM PCR master mix (Cepheid, Sunnyvale, CA). The median age of the 167 patients in the study was 3 years (range 2 days - 18 years). A total of 85 (50.9%) patients were male. The majority of the isolates, 153 (91.6%), were obtained from outpatients. Isolates were obtained from skin or soft tissue infections in 148 (88.6%) patients. Other common sites included the nares in 10 (6%) and rectum in 4 (2.4%). Three of the isolates (1.8%, 95%CI: %) were highly resistant to mupirocin by E- test. None of the isolates demonstrated intermediate resistance. A total of 23 isolates underwent Mupirocin resistance pediatrics 4

5 PCR testing for the iles-2 gene, including all of the resistant isolates. The iles-2 gene was demonstrated in all of the resistant isolates but none of the other isolates. A total of 1031 mupirocin prescriptions were dispensed from our institution during There was a steady and marked increase annually in the number of prescriptions, such that by 2007, there were 2170 prescriptions filled, an increase of 110%. Antimicrobial options for treatment of MRSA are limited, so it is critical to monitor for emergence of resistance to commonly employed agents. As far as we are aware, this is the first study investigating the rate of mupirocin resistance among pediatric patients. We have shown that rates remained low in our population despite an approximately two-fold increase in mupirocin prescriptions over 5 years. Our level of resistance is lower than in previous studies in which the majority of patients were adult inpatients.(3, 6, 14) The 2005 Infectious Diseases Society of America (IDSA) guidelines on the diagnosis and management of skin and soft-tissue infections recommend mupirocin as the first line agent for impetigo in patients with a limited number of lesions while taking into account local resistance patterns.(18) Mupirocin can still be considered effective therapy for impetigo in our pediatric patients given that we have demonstrated a low level of mupirocin resistance. Eradication strategies for outpatients with recurrent MRSA skin and soft tissue infections frequently employ nasal mupirocin along with different combinations of other agents such as chlorhexidine, rifampin, and trimethoprim/sulfamethoxazole. The effectiveness of such strategies to reduce colonization and the risk of skin and soft tissue infections in pediatric outpatients is controversial. There is wide variability about the use of such strategies among infectious disease specialists.(19) A frequent concern is whether mupirocin resistance will limit its role in eradication strategies. We have provided insight into this question by showing that Mupirocin resistance pediatrics 5

6 despite a dramatic increase in mupirocin use in our population, mupirocin resistance rates have remained low. Our study had limitations. First, only the initial positive MRSA isolate for a patient was included in the study. Rates of mupirocin resistance could be higher with additional isolates from the same patients. Second, we did not type our isolates by pulsed-field gel electophoresis (PFGE), so the breakdown of specific MRSA clones among our samples is not known. This may be important as previous studies have shown different rates of mupirocin resistance among specific clones.(12) In conclusion, we have studied the rate of mupirocin resistance among pediatric MRSA isolates at our institution. We have shown that rates remained low despite increasing use of mupirocin. This has implications for the use of mupirocin in pediatric patients for skin infections as well as in regimens designed for MRSA decolonization. We wish to acknowledge the following individuals who provided a great deal of assistance in the completion of this study: CPT Dana Perkins, PhD, LTC Helen Viscount, PhD, Haengcha Chong, Troy Patience, Chris Gibson, Mary Meyers, and David Tomich. The opinions or assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the Department of Defense. Mupirocin resistance pediatrics 6

7 112 References Kavi, J., J. M. Andrews, R. Wise, M. D. Smith, M. Sanghrajka, and S. Lock Mupirocin-resistant Staphylococcus aureus. Lancet. 2: Rahman, M., W. C. Noble, B. Cookson, D. Baird, and J. Coia Mupirocinresistant Staphylococcus aureus. Lancet. 2: Caierao, J., L. Berquo, C. Dias, and P. A. d'azevedo Decrease in the incidence of mupirocin resistance among methicillin-resistant Staphylococcus aureus in carriers from an intensive care unit. Am J Infect Control. 34: Deshpande, L. M., A. M. Fix, M. A. Pfaller, and R. N. Jones Emerging elevated mupirocin resistance rates among staphylococcal isolates in the SENTRY Antimicrobial Surveillance Program (2000): correlations of results from disk diffusion, Etest and reference dilution methods. Diagn Microbiol Infect Dis. 42: Gadepalli, R., B. Dhawan, S. Mohanty, A. Kapil, B. K. Das, R. Chaudhry, and J. C. Samantaray Mupirocin resistance in Staphylococcus aureus in an Indian hospital. Diagn Microbiol Infect Dis. 58: Jones, J. C., T. J. Rogers, P. Brookmeyer, D. W. M. Jr, G. A. Storch, C. M. Coopersmith, V. J. Fraser, and D. K. Warren Mupirocin resistance in patients colonized with methicillin-resistant Staphylococcus aureus in a surgical intensive care unit. Clin Infect Dis. 45: Jones, P. G., T. Sura, M. Harris, and A. Strother Mupirocin resistance in clinical isolates of Staphylococcus aureus. Infect Control Hosp Epidemiol. 24: Mupirocin resistance pediatrics 7

8 Kresken, M., D. Hafner, F. J. Schmitz, and T. A. Wichelhaus Prevalence of mupirocin resistance in clinical isolates of Staphylococcus aureus and Staphylococcus epidermidis: results of the Antimicrobial Resistance Surveillance Study of the Paul- Ehrlich-Society for Chemotherapy, Int J Antimicrob Agents. 23: Miller, M. A., A. Dascal, J. Portnoy, and J. Mendelson Development of mupirocin resistance among methicillin-resistant Staphylococcus aureus after widespread use of nasal mupirocin ointment. Infect Control Hosp Epidemiol. 17: Schmitz, F. J., E. Lindenlauf, B. Hofmann, A. C. Fluit, J. Verhoef, H. P. Heinz, and M. E. Jones The prevalence of low- and high-level mupirocin resistance in staphylococci from 19 European hospitals. J Antimicrob Chemother. 42: Shittu, A. O., and J. Lin Antimicrobial susceptibility patterns and characterization of clinical isolates of Staphylococcus aureus in KwaZulu-Natal province, South Africa. BMC Infect Dis. 6: Simor, A. E., T. L. Stuart, L. Louie, C. Watt, M. Ofner-Agostini, D. Gravel, M. Mulvey, M. Loeb, A. McGeer, E. Bryce, and A. Matlow Mupirocin-Resistant, Methicillin-Resistant Staphylococcus aureus Strains in Canadian Hospitals. Antimicrob Agents Chemother. 51: Upton, A., S. Lang, and H. Heffernan Mupirocin and Staphylococcus aureus: a recent paradigm of emerging antibiotic resistance. J Antimicrob Chemother. 51: Vasquez, J. E., E. S. Walker, B. W. Franzus, B. K. Overbay, D. R. Reagan, and F. A. Sarubbi The epidemiology of mupirocin resistance among methicillin-resistant Staphylococcus aureus at a Veterans' Affairs hospital. Infect Control Hosp Epidemiol. 21: Mupirocin resistance pediatrics 8

9 Walker, E. S., F. Levy, M. Shorman, G. David, J. Abdalla, and F. A. Sarubbi A decline in mupirocin resistance in methicillin-resistant Staphylococcus aureus accompanied administrative control of prescriptions. J Clin Microbiol. 42: Yun, H. J., S. W. Lee, G. M. Yoon, S. Y. Kim, S. Choi, Y. S. Lee, E. C. Choi, and S. Kim Prevalence and mechanisms of low- and high-level mupirocin resistance in staphylococci isolated from a Korean hospital. J Antimicrob Chemother. 51: Chaves, F., J. Garcia-Martinez, S. de Miguel, and J. R. Otero Molecular characterization of resistance to mupirocin in methicillin-susceptible and -resistant isolates of Staphylococcus aureus from nasal samples. J Clin Microbiol. 42: Stevens, D. L., A. L. Bisno, H. F. Chambers, E. D. Everett, P. Dellinger, E. J. Goldstein, S. L. Gorbach, J. V. Hirschmann, E. L. Kaplan, J. G. Montoya, and J. C. Wade Practice guidelines for the diagnosis and management of skin and softtissue infections. Clin Infect Dis. 41: Afghani, B., V. Kong, and F. L. Wu Use of nasal mupirocin for eradicating meticillin-resistant Staphylococcus aureus: a dilemma? J Hosp Infect. 64: Mupirocin resistance pediatrics 9